Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E133G03
Clone ID E133G03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE133G03
Sequence
ATTAATTTAAATAAAAAGAACTCAAAGCTGTCATTTATTAACTACCTTTTCACAACTAACCTGAATTGATTTTTATCTGG
CATCTGTACTTTTATAATTGTTCTTATTAAATACTTTCTCTTGGGGCTGGAGAGATGGCTCAGCGGT
Sequence Type genomic DNA
Unitrap ID UNI29621

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95579845..95579991 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es