Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E133E10
Clone ID E133E10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE133E10
Sequence
ATAATAAACATTAAATCTTAAATCTGCTTAGCCTAACAGTTTAGACACTCAGCA
Sequence Type genomic DNA
Unitrap ID UNI1744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127506690..127506743 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es