Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E133C08
Clone ID E133C08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE133C08
Sequence
TGGAATCTAAACCATAAGCACGGCCCTGAATTCTTTGTAGCTTATTTTTGGTGCTTCCTGAACCAGCTGGACTCGCCCAG
CTGTGTTGACAGGCTGTGTGGCATTAGGTCGCTCTTCCCTTTAAAGGCTCCAAGTCACCTGGCCCCCTGCTGTAAGTTTC
TCTGCCCCTGAAGAAACAGATAGGCATCTTCCTTTCAAATAACTTAGCTCGGTGTGGTAGCCACAGGCCTCTAGTTCCAA
CTCAGAGGAGGCTGAGACTTCAGTTCAGGCCAGGTCTGGACTGGGAG
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95084592..95084878 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es