Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E133A06
Clone ID E133A06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE133A06
Sequence
CTCTTCCTTTCCCAATCTGCCCTCTTTCCTGCGTGTTATACGNNNCCTCTTTCCAGTAATTCACGCTCTTTGGAAATCCG
AAGATGGTGATAGAGAGGAATACTGTGTCCACTTCTTCTCACTGTCGCTGTTTCTCTGGGAAAGGTGATTGATTCGTACT
TGAGGAGATAGGACTCAGACTGTCCTGGAGCCCTGGATCAGCTATCAGCTGTGCTGATTCCTGGCTTCTTAGTTTGTAGC
AGATGTCTGTGCCCTTCTTGTCAGAAATAAAAGCATGTGAGATTTTGCTCAAACCACAAGTTATGCCAAGAGTGGCAGGT
TTTTTGTTTGTTTTAGTTTTTGGTATTGGGGGCTAGAGATGCAATCCAG
Sequence Type genomic DNA
Unitrap ID UNI10418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138032614..138032981 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es