Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E133A05
Clone ID E133A05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE133A05
Sequence
GATCATCCTACGCCATCATCCTTGTCGGCTGAAGGCCTCTTCGCCGGGTCAGGAAGCACTGGGCTTCCTATGTTAAGATG
CTGTTCAGCTCCTCAAGTGTACTCAT
Sequence Type genomic DNA
Unitrap ID UNI29625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 152315683..152315788 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039058 (Ak5) NM_001081277 adenylate kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2677491]

 
Come back to gene ENSMUSG00000039058


For any suggestions or comments, please send an email to unitrap@crg.es