Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E132G08
Clone ID E132G08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE132G08
Sequence
TCAGTGCTGTGTGTCACAGGAAAGGGGGTGGGGATTTATGTGGATAACTTGTCCTTGCTAGAAGAGGATATTCAGGTCGG
GGTTGCCCTGGGAAGAGGGAGTGGGTGATTTCTTCCTGGTTTTAGAACTCCCNNTAGCGGAAGTGGCCCTGGAGAGCCAT
CTGCCTTTCACACCCCTCCCCCACCCAGACTGGAAAATCCAGGTATTCTGTCTCTTCAGTCCGTGGCCTGCAGGCAGTAG
GAAGCTAGAGTTGGAACTCTGGAGAATGCTGGGCAGAGACCTGGGTGTGGGCAAAGTTCAATCTCATAGGCATGGTTGCT
ACCCAACTTTCCAAGGCTTCTCTACAGTCAGGGAGAATCCACTTAGACTGGCTTGATTTTTTGCGGT
Sequence Type genomic DNA
Unitrap ID UNI29628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97663026..97663412 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es