Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E130E04
Clone ID E130E04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE130E04
Sequence
CTGTCAGCTCTAAGATAACGCTTGGTCAGTGTTTGCTTTCTTGAGTGCTGTGGTTTCACTGTGATTTTGAAATACATAAA
TAAACTTGGTCTTGGGAGATCAGTGCTAAAATATGTACAGGTAAAATGATAACCAGACCTGTAGCATGTGCCTAAGAGCA
AACCCTGGGGTCTGTACACATGGCCGTGTGTGTGTCTCACAAGCATGTGCA
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57289348..57289559 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es