Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E130D01
Clone ID E130D01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE130D01
Sequence
GATCCTGTCGGGGGACCACAACCCACCTTACACATTTCGCCGCCGCCGTGACCCCGACTCCCCGTCGCCGTTCAGGCCCC
GGGGCCTCGGTCTCCCCGCCTGAGGGCCCCGATCTGCCCCTGATCCCAGTCCGCCCGATTAGTATGCCCGCCCCCAGTCT
TCTGTCAACTTCCTGTGCTGGCCCCAAAGGAATGTGTGAAGGCAAAAGTCAGCCTGGCTGCAGCCTCTGTTTACAAAGCT
TCTTGAGAGCCAAGAAGCACCCTCCCTCCCATGGGCTCAGAATGACCTAGGCAAAGAGCCCCTTGGTCCCCGCC
Sequence Type genomic DNA
Unitrap ID UNI20144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108363116..108363429 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049305 (Ccdc71) NM_133744 coiled-coil domain containing 71 Gene [Source:MGI Symbol;Acc:MGI:1919704]

 
Come back to gene ENSMUSG00000049305


For any suggestions or comments, please send an email to unitrap@crg.es