Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E130A09
Clone ID E130A09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE130A09
Sequence
AAAACGAGTACAATAAAACTGATTGACATAATTTAATCCTAAAATGTGAAGGACTATTGCAAGTAACATTGTCAACCTGA
AAATATGCTTCTTCAGTAAGGACAACATTGGATTAGAGAACAGCAGCCTAGCTCCCAACAAAAAGAAGAAAACACATTTC
CAGAATATGGTAAGGAATTCCAGTTACTATGTGAAGAACTGTAGGTTACCTTGGATGGCTTGATTAAAATAGAAATAAAA
ATAGAAAAGCTGTATACCAAGAGAATTTGTGAACTGGAGAGTAATCATTATGAAAAGGGTACTAAATGAACCCCACTGTT
TCACACGAGGCCAAAACCCATTTTATGAAATCCCCTGCCTGCTCTCTGGCATGTACAGAAAGGAAATCCTCCTCAGCACA
CTATTAGGGTAGAGCTGGCCCCTCATCAAACTATGACCTCATTCTGAGATGCCTGTCCTTGTGGCTATACCTGTAGGGAA
AAAAAAGAAAGCAAGCTAAAACTAGAGAGCACACTGCTCAAAACAGGCCCAGGCCTCATGACTCCCCAGATACCTTGGTC
TCTGAGCATAGCCTAGGCTGCAGACCATTGGTTAGACAGTCCCCGCTATAGGACC
Sequence Type genomic DNA
Unitrap ID UNI8717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23296635..23297249 615
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036769 (Wdr44) NM_175180 WD repeat domain 44 Gene [Source:MGI (curated);Acc:Wdr44-002]

 
Come back to gene ENSMUSG00000036769


For any suggestions or comments, please send an email to unitrap@crg.es