Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E130A06
Clone ID E130A06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE130A06
Sequence
GCAGGAGAGAGACACTGACTCTACTGTCCCAAAGCTGTAAGGGAGTCATTTTCATGACTCTCTTAGGACTCTTTTGACCA
AGCAAAACTATGTGACTTAAAAGAGTTGAGTTTCTGGCCGGTCATATTGAAAGACTAGTCAGCCTGAGCTCCCCTGTGCC
ACGAGCCATTCCTTGTGAGACACTCCAGACACTGCAGGGTGCTGTCAGCATCCTTGCCGGGAGCTCCCTGAGTGTAAAGA
CTTGGAACAGGAGTATGTTCACCCATAGGTCATCCCAGCCTGCCCCAGGGAAAGCCACT
Sequence Type genomic DNA
Unitrap ID UNI14420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79135081..79135379 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]

 
Come back to gene ENSMUSG00000020308


For any suggestions or comments, please send an email to unitrap@crg.es