Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E128E06
Clone ID E128E06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE128E06
Sequence
GTGTGCATGGCCACTTTGTGACTTCATATCAGGACACTTGTACTCTGTGGCCTGGGTCCTGGTGTCTGTCTGTGGTATGT
GTGTGCTTCCCTTTTCTTGAGTGGTGTCCCTTGGCATCTAGTGCTTGCTCTCCATAGTACTCAGGTTCATAG
Sequence Type genomic DNA
Unitrap ID UNI20476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117859137..117859288 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es