Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E128E02
Clone ID E128E02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE128E02
Sequence
TCACTGACATTGAGATTTAAACAATTGATTTTTACATGTATTTATTTTGTGTATGTATGTGTGATGGGGATATATATCAC
ATCGTGCAATTGAGACTGGATTAAGTTTGGTAAACACGGCACTTTGTCTCAAAAATGAAACGGGGGAGCAGAT
Sequence Type genomic DNA
Unitrap ID UNI27532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55860419..55860571 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005656 (Snx6) NM_026998 sorting nexin 6 Gene [Source:MGI Symbol;Acc:MGI:1919433]

 
Come back to gene ENSMUSG00000005656


For any suggestions or comments, please send an email to unitrap@crg.es