Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NST005
Clone ID NST005
Vector pGT1.8TM
Project baygenomics

Sequence tag NST005
Sequence
CNTCTAAGNCGAGGGATTTTAGGTGATGGGAAGATCAGAAAGTCAGATGGATATAACTGATATCAATGCTCCAAAGCCAA
AGAAGAAACAGCGATGGACTCCCCTGGAGATCAGCCTCTCTGTGCTTGTCTTGCTCCTGACTATCATAGCGGTGACAATG
ATCGCTCTCTATGCAACCTATGATGATGGCATTTGCAAATCATCAGACTGCATAAATCA
Sequence Type mRNA
Unitrap ID UNI9485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63104046..63104931 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027820 (Mme) NM_008604 membrane metallo endopeptidase Gene [Source:MGI Symbol;Acc:MGI:97004]

 
Come back to gene ENSMUSG00000027820


For any suggestions or comments, please send an email to unitrap@crg.es