Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E127G07
Clone ID E127G07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE127G07
Sequence
TATACATACTAGCGTGCTCTTTCTTTAATAAGAAAAAAGTAGCATTGAAGCTTTAACACTGCACTTTGAACATCTTTTTT
CATGATTGTGTTATTGATATAGCAAGTGATTTACCAACAGGACCAGACACTCAAATTAAACATAAAATGCAGCTGGATGT
TGTAAATGGCTGTTAGACAGTCCCTGCTACACAATACTGTTATAGAAGCCAGATGTGCTCTCTCAGAGCCTGAGTCACTT
TCAGAATCACATGGCCATACTCATTGCTTGGAAGGGAAGAGAATCCATTAATAAGAATAATTTGGGAAAAAGCAAACCCT
GACATCAAACGGAATCGAGACTAAAACATAGACATGTAGCTTTGTTTCCCTGAGGAATAATGGCCTCCGTGTCATCGCTC
ATTCGATTATGTACTCCTTTAGTAGATACTCT
Sequence Type genomic DNA
Unitrap ID UNI29646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135681593..135682024 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]


SPLK-Sequence tag 3SE127G07
Sequence
GTCTCTGGTTGTCTGCTAAGTGCCTATTACTGCTAGGGACTGGGTTTAGAGAATAGAGAAGGGGGGAGGGTCACAGACAA
ATAAGCCACGATCTTTTTCTTGTCAGGCTGCTCATACTAAAGAGTACATGTGTTTGCTCATAGTAATTAGTGTCATCCAG
AAGGCGATGTTATAGTTTTATATGCTTCCTTGAAAAAAATTCACTGATAGATGATTAATCCTATTATTTTATGTTCTCAA
ATTTCTACCCAGGATCATTTGCTAGTTTCTAACTGCCCATCCTCTTCAGTCCCTGGAG
Sequence Type genomic DNA
Unitrap ID UNI29646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135682021..135682318 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es