Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E127G05
Clone ID E127G05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE127G05
Sequence
GATCTATGGTTCTGCATTGTAGAAAGAGCCCTGCTCAGTTTGGCTCTCAGCTCATCCCTTCCTCGTACATCGTACAAG
Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53735247..53735324 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es