Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST018
Clone ID RST018
Vector pGT1.8TM
Project baygenomics

Sequence tag RST018
Sequence
GNNGTGTAGTGAAAGAAGACGTCCCTACTGGCTCATCAGTCATGACCGTGTCAGCTCACGACGAAGACACAGGCAGAGAC
GGAGAGATCCGGTATTCCATTAGAGATGGCTCTGAATTGTGTCTTCAGATAGATGAGAACA
Sequence Type mRNA
Unitrap ID UNI8594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46038692..46038827 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

 
Come back to gene ENSMUSG00000070047


For any suggestions or comments, please send an email to unitrap@crg.es