Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E127A05
Clone ID E127A05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE127A05
Sequence
CACTTTTTACATTAAGTTCGACGGATGGGGTGGGAGTTGTGTGAGTGTGAGGCTTTGACTTCTGAAATTGTCCCGTTAG
Sequence Type genomic DNA
Unitrap ID UNI25270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26788259..26788338 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014867 (Surf4) NM_011512 surfeit gene 4 Gene [Source:MGI (curated);Acc:Surf4-001]

 
Come back to gene ENSMUSG00000014867


For any suggestions or comments, please send an email to unitrap@crg.es