Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E127A03
Clone ID E127A03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE127A03
Sequence
GATCCACCTGCTTATTAAAGGTGTGTTTTACTGTTCATTTTATTAGTTAGATACAAGTGATGCTTCATCATCTCCATGTA
CTCCCTTGCTGTTGCAGTCTCTTCTCCAGGAAGAGCATGTTCACAACTTTTACTTATTCTTTAAGTGACATTGTTGGTTT
TATATAGAAATGGAAGAGTCATACACTCTGCTCACCAGTGTTTATCTGGTGGAGACATTGTAGCATTTTATCCCAGGCTG
GCTTTCCATTTTGTTGTTCTTGTGATCTTGAGGACTAACTTGGGACTTCACCGGTGCTAGCCCAGAGCCCTACAACCAGG
CTCAGTCCCCCACCCTAGATGGCATAGTTTGATCATGATACTTACTGG
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115500094..115500461 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]


SPLK-Sequence tag 3SE127A03
Sequence
CAGCACCAGGCCTATCCACAACAAGGAAGCTTCAGTGGCTCTTCCTCTCTGTCTTCCCTGCTCTCTCTCCCTCAGTTGTC
CTACCTGATAGCTTGAACAGGGGTGCAGGGTACATAAGGAAAGATGGAACGCTGGCCAGAAGCATTTTACTAA
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115501035..115501188 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es