Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E125H09
Clone ID E125H09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE125H09
Sequence
GACCTTGTCTTAAAGAAATGCAAAGTGCTGGCTTGGTCGAAGTCTCAGTACAAAAGGCATGGAACATTGTAGAATC
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82328149..82328224 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]


SPLK-Sequence tag 3SE125H09
Sequence
CAGGATCACCTCGCATGTTTAGATTAAATTTCTTCTGGGAAATATAATCCAGAAACTATAATACTGATTTCTCTGTAGGA
ATAATCCTTAGCAAGACAGCTCTCTCCACTCATTATGTTTATGAGGTTATTCTTTCTACTAATAGACATTTGTGATCACA
CTTTTCTCGACAGCCTCCATATTCCATTNNAAAGCTGGACTCAAATAAAAGTTGGGTGAAATTTTAGACTTCAGTTCAGT
CTTNNAGAGTAGGATATTGGCAGTATTATTAAAAGGCCGAAATGAGCAGTAATATGGAAATTAAGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es