Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E125E02
Clone ID E125E02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE125E02
Sequence
CAGGGCTGCTGTTGACAGAACGCGTGCGCTGAGCTCGGGGCGCTGCTTTAAGCCGCTGCTTTCCCCTCCCATCCCCCCTC
ACGTCTCTGGCCTCTAAGATGGAGGTGAAGGCGCAATTCCCCGGGCGCTCCGGTGCGCCTCAACTTTCCCAATGCTGGCT
CACCCTTCTGGGTAGCCTGCCCGAGCGCGTCCCAACCAAGGTCGTCTAGTCTCGCTAGCGTTTACTTTTCAAAGGTCGTG
TGTACCCAGTTTACGCGTGGAGAGGAGGCACTGGGGCGGTCTCTGCCAAGGACCCAGTGCCCAAGGCGGGAGAGGAGGTC
CTTGGGGACCCCTTCCCTTCCTAACTTTCTAACTGCTGGGCCCAGTTGACTCTGGGTTGGCCCGGCAGTGGTGGCAAACC
GGAGCAGGAAGACACAATTCCTGGAGTTCAGTGCCGCGAATTATTGGAGCGGACTCTGCCGTTGTAGCGGGGAGAATGGG
ATGCAAGACAGGTCCCAAACCTTTTGGCGGTGGAGAGACCATAAGACCAATTAGG
Sequence Type genomic DNA
Unitrap ID UNI10502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88724972..88725506 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es