Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E125D07
Clone ID E125D07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE125D07
Sequence
TTAGCAGTGGGAGAGAAGATGGAGTGGAGGGTTTTATGTAGAAGACAGGCAATTCAAGTTCATTGTAGAAAAAGCCTAAA
AGTAAAGTGCTCAAGTGCATTCATCTATGACTCTTAGGTCTGTGAGCTCGCGTGGCAGGATGTCTGGGGATTGGGCTATA
CTTTGGGTACTCTGGTGAAATGGTTTTTAGAGATTGGAGTAGGTAGACAGGGCGCTGACTGATGAGGTAGAGGAGCTGTG
G
Sequence Type genomic DNA
Unitrap ID UNI6667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45568548..45568788 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es