Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E125C08
Clone ID E125C08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE125C08
Sequence
AGCTCTAGATGTTCTTTAAAAAGAAAAAAAAATTTACCCTCCCCCTAAATCCCCTGGCCTGGCTTCAAAATGTTCTTTTA
AAACTTTGTTGGGTAATGGTGTCCATCTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI5233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122439301..122439416 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es