Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E125B09
Clone ID E125B09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE125B09
Sequence
TAGCGAGGAGAGCAGGGAGAGGCATGGGGGTCACGGTTCTCAATTTGGCCTGNCTTGTCTCCAGAATTCTCACCCAT
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17250427..17250503 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


SPLK-Sequence tag 3SE125B09
Sequence
ACTGTGCTTGCAGGGNNCAGAATCTGCATGTGATATGGTGCTACATAGTGTATGTCTCCAGACCTTGTAGCATCACACAC
CCTCTGTGCTTTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es