Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E124D02
Clone ID E124D02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE124D02
Sequence
GATCACAAAGGAACAACACGGCATGTGACTTCCTGCCCTTTTTAGTTCCTGGGCTGGCTTGTTATTTATCCCTCATATCC
GGGGAAATCTCCCTCAGTGTCCCACTGTAGCCCATGTGCCTTGCCCTCCGCAGCATGCTCTCTGGCCTCTTTCTCATTTT
TATGGTTTTTATAATCAACCAATGTGTCCTTATGTGCTTGTTGTATATCTGCCCCTGGAAGATATATAGTGTTTGATAAG
TGTTGAGATATTGTCCAGATAGATAGTTAAAAACCCAGGTACCTACTCTCTTAAGTGTCTCTTCCTTTCCCTAGGCCCAT
CCAAAACCGTACCTAAAACTACAGTCTAGCTTCAAGCAT
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649868..164650226 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]


SPLK-Sequence tag 3SE124D02
Sequence
GCATCAAATTACGTGGCACTTGAGAAACGTAGTGCTTCCCTGACGGCCGTCGATCTTGCAGAGGAAGG
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164650223..164650290 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]

 
Come back to gene ENSMUSG00000017764


For any suggestions or comments, please send an email to unitrap@crg.es