Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E123F11
Clone ID E123F11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE123F11
Sequence
GCATCTAGGCGCNNNCGTCCTGGTTGGTTCCTCACCGCCACTAAAGGTTTAGGGTCAGGGCCCAGAAACAGGCTCCTGAG
ATTTATTTCGCAAGCGGTGCACTAGCTCCCAAGTTTGCATACGCAGACCCTCACTAGAGAGGACAGACCTGCGTATTTAG
G
Sequence Type genomic DNA
Unitrap ID UNI29662

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120442167..120442325 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025132 (Arhgdia) NM_133796 Rho GDP dissociation inhibitor (GDI) alpha Gene [Source:MGI (curated);Acc:Arhgdia-001]

 
Come back to gene ENSMUSG00000025132


For any suggestions or comments, please send an email to unitrap@crg.es