Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E123F10
Clone ID E123F10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE123F10
Sequence
GCAATTCTCGTGGTGGAATCCTGGGCTTCCTGAGTGCTAGGCAAGTAGTGGTCCTACATTGAGTTCCACCTAAAGTTGGA
ATTAGACTTAGAGTACAACAGAACATCTGGACTAGAAACACAGTTTTTTTTCTTTTCTCGTATAAAAGTCCACAGAGGTA
GTGCAGATGTGATGTAGTAAGTGTGTCTGAGTACCAAGAATGCAGATTCTTCATGTGTTTGGATTCCAAAGTTACCGCAT
GAACAAAATTGCAGCTAGAGCTTGACATTGAAGTTTCAGGTCTTTA
Sequence Type genomic DNA
Unitrap ID UNI3822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13558225..13558510 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031918 (Mtmr2) NP_076347 myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]


SPLK-Sequence tag 3SE123F10
Sequence
AAAGTCATGCTTTGGAGATGATAGGTTGTAAAGCTGCTGTGCAGTTGCCTCCTGCATGGAACTGTGGCCATGGCTAGCTG
TAAGGCAGCCTAGGCTAGTAAGCTCTGTAGGCTCTAAGACTTCCTGCTAAGGCAAAGCTTGGAGGTTTTGACTAAAAGAA
TAGGAGAAA
Sequence Type genomic DNA
Unitrap ID UNI3822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13558511..13558679 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031918 (Mtmr2) NP_076347 myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]

 
Come back to gene ENSMUSG00000031918


For any suggestions or comments, please send an email to unitrap@crg.es