Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E123F02
Clone ID E123F02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE123F02
Sequence
TGGTTTAGGTCTAGGGCTTTGCATGTTCCCACAGAATGAAACAAGGGAGCGGAGGTGAGAAGGGCAGGAGAATATCACCG
GAAAAGTGAAACTTGAACTCCTAAAAATGTGCACCGGA
Sequence Type genomic DNA
Unitrap ID UNI29663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4782163..4782279 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]


SPLK-Sequence tag 3SE123F02
Sequence
CACAGTAGGTAAATGCATCTTTTTTGGAAATGTATTTAAAGGTGTTGACTTGAAACTGAGACTTCCCTTGGGTCTGAACA
AGTCTCTTTTTAAGTTTTTACCTATAAAAAAG
Sequence Type genomic DNA
Unitrap ID UNI29663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4782409..4782520 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]

 
Come back to gene ENSMUSG00000034285


For any suggestions or comments, please send an email to unitrap@crg.es