Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E123E10
Clone ID E123E10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE123E10
Sequence
GAGACCTTGAGTCCCCGGAGGTGGTGGCTGCCTTCCCAAGGGTGTCCGGAGCTTGCTCTCTTCCCTCTAGTAACCGGAGT
TACTTGGTGTCTAGTGGCTTACCAGACTGGCAGGCCCTGCGTTGTTTTTTGGGAGAGCCCGCTCTGAGGAGAGTCTCCAC
AGCCAGTGACACCAACACAGAAGTGACCTGTACTGATACCCCCTCCCAACCCCCCACCCCCAGCCTGCTCCAATGTTTGC
AGCCAAGGTGCGGTTTGCAGTGGAGTGACCCGCCCTAAATGCGCTGGCCGGCAGCCTGTGCTCTCATTGGCCTCCCCC
Sequence Type genomic DNA
Unitrap ID UNI17985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124896351..124896668 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]


SPLK-Sequence tag 3SE123E10
Sequence
CATCCCTCAGCCACAGTCCTGGGAGGTGCTGAGCCGCAGTTGCTTGAGAGGGGCCAGGCCTATCGCGGAAGGTTAAGGCA
CTAAGCAAGCCCTCCCAGTTGGCCTCAGCACCTAGTGGTTAATCAGGTTCCCTTAGGCAGGCCTGTTTCTGTGTGTTGGT
GGCCGACTCCCTAGCCTGGGGAGATAACCCCTGACTCAGCCCAGCCCTTCGAATCAGTTTTCCCTGGGTCATTCTGCCCT
CCCTGCTGCTGGTAGGTTAGCTCTTTCCTTAAATGGACTGTACCTTCCTTTAAGGTCTTGTCCTCTGCTGGCCAGACTTA
TCCCTTAGGGACTCTGCTTAGGGAGTGTATGTGTTCAGAAACCTGGGGCTTCCAGAATCTGCCGCAGCTCTCCTGAGAGA
GCGAGAGGTCTCCTGGGGCTGGCATCTTCTGGTTGGCATGTCCTGGAGTGGTGATGAAATCTCTTTTGTATTCTTCCTTC
TCCTTCTTCCCCTCAGACGCTGGGGGATTGTCTTTGTCTCCAAGCCTCTTTCAGAATATGTGTTTGTCTTTCTAGGAGAA
CGTGTTTGCTGGGCAGTCAAAGATC
Sequence Type genomic DNA
Unitrap ID UNI17985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124896668..124897252 585
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es