Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E123D03
Clone ID E123D03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE123D03
Sequence
GATCTGAGAAGCCCACGTATGATCTTAGGCATCTTTAGGAAGACCTGCATCTGAACTTGCAACCAGCAAGCAGTCCAGCT
GGCCCGTGCTGCTGTGACTCACACCTCCTTACTGGTTACATCTCTTTTGTACCTGGCACGTGCCTGCTATTGTGTGCCAC
CTGCAAAAGACCCACTATCAAGTTCCCTG
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24337479..24337667 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]


SPLK-Sequence tag 3SE123D03
Sequence
GTCACTGCATATGACATTTTTATCAGGGCTTCCTACTGTTATTCCGCCTTCAAATTTAACGTGGGCCCAAGTCTACCCAG
TTCCTTCTCTAGTTTCTTCCTTGCCAGGCACACAGGGTGTAACGTGACATTTGGGTATGGAAGTTACAGTCTAGAAGAAG
AGTGGGACATACAACAGATGGTGACCATACCTCAGTGTGCCGAGGCGTGCAGGCAGATGTGGATACGGGGGCTCTGGTCT
GGAGGAGCCAAGAAAGAGGGGACAACAGTGTCCTGCCTCTCTTCCTTTCTGTTCCTTTAGAAGTGACTCGCCTCTGATTA
TACCTGGCGACTTCAGCTTGCATGGTGTGGCCAGTGCTCCTGAAGCTGCTGTGGNNCGGGCAGGAAGGCTGAGGACAGGA
AGGCTCTCTGTAAAGCAGTAACAGGACAAGCCCTGGGCTTGGCACAGTGGGAGGGAGGATTTGAGCTGAGTTGTGGTGGA
GCTGTGGAGCATGAAGGTCATGAGATGCGCTGTTTGCCTAGGAAGCAGCTGGAGGTAAGGTACCAGAGCTCACATGACAT
CTACAGCAGTGACATTGAGGGACCAGAGCGGGCAGAGCTGGAGCAGGAGCAGAGCCAGAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es