Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E123A09
Clone ID E123A09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE123A09
Sequence
ATACGTGTAGGCAAAACACCAGTGCACAAAAATTAAAGGTAAATCTTTTAAGAAAGAAATTTCAAATTTTATATACATAT
ATAGGTTTGATTTGAATACACTATGAAATCCATTATGGCTTACATTTTGTGGACTCTTGAGTTGGAATAAAGACTAGAAA
GGCTAATTATTTTGTTGACTAGGAAGGAGGACTTTGGGTTCATCGGTGCAGGCACCCTGTGACTCAGTTCTTCCTTAGG
Sequence Type genomic DNA
Unitrap ID UNI5320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88141136..88141374 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001415 (Smg5) NM_178246 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447364]

 
Come back to gene ENSMUSG00000001415


For any suggestions or comments, please send an email to unitrap@crg.es