Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST219
Clone ID KST219
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST219
Sequence
AGCTTCTTCCCCGTCGTGGAGGCCATGCAGAAGTACTTCAGTGCTGGCTCGGGGACCTACTACAGCGACTCCATCTTCTT
CCTCTCCGTTGCCATGCACCAGATCATGCCCNAAAGNNTCCCAG
Sequence Type mRNA
Unitrap ID UNI10259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31050719..31050828 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047434 (AI480653) NP_941028 Uncharacterized protein C3orf21 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G3]

 
Come back to gene ENSMUSG00000047434


For any suggestions or comments, please send an email to unitrap@crg.es