Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E122D05
Clone ID E122D05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE122D05
Sequence
CACGTTTGCNNAGCGCTCACTGTGATGGTTCTGAGACCACAGCAAAAAGCAGTATCAGGAAATCTGCCCCATGGTGCCAG
AGGGCTGGTCTTCTAGGCTTGTGTGATGAGAACGTGGTCATGTGATAGGGAAACCGAGCCTACTGTAGTATGGATTCATG
GAAAACCACAATGA
Sequence Type genomic DNA
Unitrap ID UNI18060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16561773..16561945 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070808 (Gltscr1) NM_001081418 glioma tumor suppressor candidate region gene 1 Gene [Source:MGI Symbol;Acc:MGI:2154263]

 
Come back to gene ENSMUSG00000070808


For any suggestions or comments, please send an email to unitrap@crg.es