Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E122C07
Clone ID E122C07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE122C07
Sequence
GATCTAGGACCCCAAAGCCCTTTTGATGATGAAGCCATGAGTCCAAG
Sequence Type genomic DNA
Unitrap ID UNI11774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53068898..53068944 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003269 (Pscd2) NP_035311 cytohesin 2 Gene [Source:MGI (curated);Acc:Pscd2-001]


SPLK-Sequence tag 3SE122C07
Sequence
CTCAGACTTTTGGTACCCATTCCTCTTCTGGACAGGAATCCAGGCCCCCCAGCCCAAATCCTTTCTCAGGATGCAGGAGT
CCTGACCCCCAGAACTAATTTCTTGACCCTGGTCCCCAGAGCCCCCAGACTTGACTCCAGAGGAGCGCATGGAGTTGGAG
AACATCCGGCGGCGCAAGCAGGAGCTGCTGGTGGAG
Sequence Type genomic DNA
Unitrap ID UNI11774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53068450..53068644 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003269 (Pscd2) NP_035311 cytohesin 2 Gene [Source:MGI (curated);Acc:Pscd2-001]

 
Come back to gene ENSMUSG00000003269


For any suggestions or comments, please send an email to unitrap@crg.es