Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E122B10
Clone ID E122B10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE122B10
Sequence
GGNTCCGGTCCCACCGTCTCTCGCCAACTCCTTGTGGGTATGTGTTTCTGACCGACGTTCCCTGCTTCCGTGGTCTGAAG
GCGATGAGTGAACTTTAAATTGTAGGCTCCGTCCGAGCACAATAATAGAGTTTCGGGTTTCTGCAGGTCCAACATTAGTA
AAGACAAATCGGTGTGTTAGATTACATAAAATTCCTTTCCCATCCAAAAGACTTTGGATTCCCTTTGGGAAGAAAAATAT
TGCCTACTGCAATTTTTAAAATGTACTAGACGTTGTAGTTTGATT
Sequence Type genomic DNA
Unitrap ID UNI15836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118873261..118873544 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027326 (Casc5) NM_029617 cancer susceptibility candidate 5 Gene [Source:MGI (curated);Acc:Casc5-004]


SPLK-Sequence tag 3SE122B10
Sequence
CAGCAATAAAACTGTGACTAAGANNNAAGTTAACAGAGATAAAGCATGTGGCTAAAACCCAAAGCAGCAGTTTATTCTAG
ACACCAAGGTTGACCGTTAGTTTTCATTTCAGTTAAATTGGTTCCGTTGAGTCCCTTGTATGTCTCATAGGTTCATTGTC
TTGTGCTAAAGTAGACTTCATGGAGATGGCATTTCATTGGTCAGATTGTTGGAGAGATGATTTATAAATATGGAAGGAAA
TATATCGTAAGGTATTTGGTCATTAAAGGTTAGGTTCAAGCAGTGTACTTCTTGACTATGTGAATGGCTGGAAACCTTTA
CAAGTTGATAGATGTAAATGGAGTAAAATGTTTGGGATGGTGATATAAATGATGTGTTTGATGCTGAGAATACGAGAAGG
TACTGATTCTAGATACTGGATCGAACA
Sequence Type genomic DNA
Unitrap ID UNI15836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118873824..118874250 419
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027326 (Casc5) NM_029617 cancer susceptibility candidate 5 Gene [Source:MGI (curated);Acc:Casc5-004]

 
Come back to gene ENSMUSG00000027326


For any suggestions or comments, please send an email to unitrap@crg.es