Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E122A07
Clone ID E122A07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE122A07
Sequence
GATCCAATGGGAGTGCAGGGAGGAAAAAACAGTGTTCTGATACAGCACTCTCCTACCGGGAAATGTCTTTCTGATGGATT
GCTGAGTCAAGGTCACCTTGGGTACCACTGACTTTAGGCATCTTTCTTTTGACTTTATCCCTTGTCCTTTAAGACGCTTG
TAAATCTTGCCTCTTGAGTTTCAGAGGAATCCACTGAGTAGTTACACCCAGCTTATTCTCGCCATCTGTTTTATTGCAAT
Sequence Type genomic DNA
Unitrap ID UNI11091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6285028..6285267 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es