Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E121G03
Clone ID E121G03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE121G03
Sequence
GATCTGGGTAGGAACACGCAGCCATGGTCTCTGGAAACCAGGGTCACAGGGCAGCCCTGCACCCTGAACTGAGCTTGCCA
GTGTCCCCTTCCACAGGTACTTT
Sequence Type genomic DNA
Unitrap ID UNI29673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22667336..22667438 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021773 (Comtd1) NM_026965 catechol-O-methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Comtd1-001]

 
Come back to gene ENSMUSG00000021773


For any suggestions or comments, please send an email to unitrap@crg.es