Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E121F07
Clone ID E121F07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE121F07
Sequence
GGTCTTTTTCTGAGCTTGTCTTGCTCCTTTGACTGGAGACCAGGCCTCAGCTGCCCTTCCACTCAGGCATGAGCAGTGAG
TCACCAGGGACAGGTCACCGTTCCGGGGGACATCATGGGGTGAATGTCAGGAAGTTGGCTTGTTCTGCCTTTCATAGGTA
ACTAGGGACACAGAGACCTGGAGGGGTGGTGACTTCTCAGACTGACTCCATGCTTTGTGCAGGAAGCAAGAAAGCTTATT
CATTCTTTTCTCTGAAAAGCACATTTCTTTTTGTGTGTGGTGGAGTGAGTGGGCTGGGTGGCATTTCAAGTTTGTATACT
TTTGGGGAGAGAGTCATTCTCTTCTGTGAACAGTCACCCAGGGACAGGTGGCTTCTAAAAACCCTGTCTTGTATCCCATT
TGGAAATCATTCCTCT
Sequence Type genomic DNA
Unitrap ID UNI29674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64243178..64243593 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036466 (Megf11) NM_172522 multiple EGF-like-domains 11 Gene [Source:MGI (curated);Acc:Megf11-002]

 
Come back to gene ENSMUSG00000036466


For any suggestions or comments, please send an email to unitrap@crg.es