Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E121D09
Clone ID E121D09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE121D09
Sequence
TCCCACACCTTTTTCTTTCTGTTGTTTGTTTGGCTTGTGGTTTTTGCTTTGT
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29692982..29693033 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es