Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST229
Clone ID KST229
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST229
Sequence
TTAACAAACAACCAGACCATTTTCAGGACCAAATTCTATCCGGGCCCATGAACTCCCTCCCTCCCTTTGAGGGTGTTTCT
GGGCCACGTGGTCTTTGATGCCAGCGGCTCCCGGATGGCATGGACGCTTATCGAGCAGCTACAGGGCGGCAGCTACAAGA
AGATCGGCTACTACGACAGCACCAAGGATGATCTTTCCTGGTCCAAAACAGACAAGTGGATC
Sequence Type mRNA
Unitrap ID UNI10264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37200271..37201681 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024462 (Gabbr1) NM_019439 gamma-aminobutyric acid (GABA-B) receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1860139]

 
Come back to gene ENSMUSG00000024462


For any suggestions or comments, please send an email to unitrap@crg.es