Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E120F04
Clone ID E120F04
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE120F04
Sequence
GATCTCCAGGATATTTACTTAATTATTAAAGAGTAAC
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62254486..62254522 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SE120F04
Sequence
AACAAGGATGTCCTTTTTTTCACCGAGTGGATAAATTTGGACAATTAACTGTCACGAAAGAAAACAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es