Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E120C02
Clone ID E120C02
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE120C02
Sequence
ACTGTGCAGACCAGCTTCCTCTTTCTCCATTGGATTCAACCCTAGGCGTCCTAGACCTACCACCTAGGTCTGTGTTGGCG
NNNNATACTCGTGTCGACTCTAGTGGGGTCCCATTTGCTTGTCCATCTTCCGCAAGCCAGAATGGAGCAGATGCTCAGGG
GAGGCTTAGATGGTTCCCTGTAAATAGTCTTCATAAACTTACTAAATTGTCATTTATCCGTGGGATAGCTAAGCTTCTCC
GTCGTCTGCCCTACGCACTACAAACTGTATTCAAATGACGGATGAGTCGCCACAACTTGTGTGTGTGTTTTCTTTTTAGA
CACAATTAACTATTTCCAAGCAGATAATAGACTGATGGATAGTTGTGATGTAGAGAAGCTGTGGATGGACAAAAGGATGA
AAAAAATCAGTTTAAAATGGGATTGAATTTTTGCCATTGAAAAGGTTTTGTTTGTCTATAGGTCATTTAATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE120C02
Sequence
AATTAAACAGTTTTTGTCGTGGTTTTNNACATACTTGTCTTAGTATTTCCTTTAAGAGCACAATGAGAACCAAATAAAAT
CTGATTTTCTATCGATGTTGATCTTTGAGCCTCAGCTTCACAGGTAAGCTTTTTGCTTATGTAGCAATCCTCAGGCCAGT
GAATAATACGAATTCTTTATTTCCCTTCCTTCCTTCC
Sequence Type genomic DNA
Unitrap ID UNI428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10931651..10931846 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049969 (Plekhf2) NM_175175 pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene [Source:MGI (curated);Acc:Plekhf2-001]

 
Come back to gene ENSMUSG00000049969


For any suggestions or comments, please send an email to unitrap@crg.es