Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E120B03
Clone ID E120B03
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE120B03
Sequence
ACCAAGAGTCCTTTTGGTGACTGCTGCTAATAGCCATCCTTTTTATTATGTGTGCATCGACCAGAGAGTGCTTCTAGAGC
CACTAAAAGAAGGAAGTTTTGAATTCTGAAGAAGGGTGTGGGTCTGTTGGGGAAACATGAAAACTGAAGGCGGCAAGTCC
TGTGGCGGTCCTTGCTAAGATGCCTGGCCAGAGCCTGTGTCTTAGGCCTGTGTCTTA
Sequence Type genomic DNA
Unitrap ID UNI29679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105564810..105565026 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032571 (Pik3r4) NM_001081309 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 Gene [Source:MGI Symbol;Acc:MGI:1922919]

 
Come back to gene ENSMUSG00000032571


For any suggestions or comments, please send an email to unitrap@crg.es