Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E119F12
Clone ID E119F12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE119F12
Sequence
GAACTCATATCTCAATTTCCCCTTCTTCACTCTCTTTACTCTAGTACTCTAGTTTTGGGCCTGTACTGTGATTTTTATCG
ACTTGAAACTTGTGTCATTAAGCTTCTATCTCAGACCATTTTGTTCTCTTATCTTGTAGACTAAGAACCCACAAAAGGAA
ACACTGGCTCTCTGATAACAGTATCACTTTTCAGTCCTTTAGCCCCTTTTAGATTTATCACTGTATCTCATATTGTCAGT
ACTGGTATTTGTTTTTTGTTCCTCCCTTCTTCAGACATTTGCATGCAATGCCTCTTCCCTACTCAGCCTCCCTATTACTC
TCTC
Sequence Type genomic DNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17756689..17757012 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]


SPLK-Sequence tag 3SE119F12
Sequence
TATGGCTATATAAGTAAGNNAANGGTCAAAATGAGATTTCCTTTTTATTGATGAGTTTCGTTTTTGAGGGAGGAATCAGC
TGTGTTTGTTACTGGCAATTTTCCCTNTTATTTTGTAGCCACTTCCGGGGGCCGAGGTATGGGTTTATTATGATAGCAAC
GATCAAAGTACTTCCTACTCATTTTTTTNAAGCTACTTCGGATTGTGGCTCTATGTGCCGTGAAGCCCTTTTATCTCCTG
GAGGTGGAAATGAACATGGTATGGTTTACAATATAATACTATAGCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es