Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E119F04
Clone ID E119F04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE119F04
Sequence
TGTAAATGAATTTAAGTGTATAAGCGTTCTTTTTTTTTACCTGTACTTGTTTGAGTGCTGAAAAGAGCCTTTTCCTTCCT
TCACTGCCTGTGTCCCTGTTGCTTTCCTTGTAGTTTCAGGTGTGTGTGTGTTGTGGAGTACTTGGTATGGTTTAAACAGG
GAAGCTTCTTCCCACAGTCACTGCT
Sequence Type genomic DNA
Unitrap ID UNI29680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35141222..35141404 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066568 (Lsm14a) NM_025948 LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14a-001]


SPLK-Sequence tag 3SE119F04
Sequence
CGATCGTTTAATAATATGTGAAATGATAAGTAAATGTATCTTAACAGTATCCTCCAAAACTCATCACCAGTATCAGAGAT
AAAACTTAATGGTAGAATGCTTGCCTAATATCAGGGGGCCTTAGG
Sequence Type genomic DNA
Unitrap ID UNI29680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35140898..35141022 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066568 (Lsm14a) NM_025948 LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14a-001]

 
Come back to gene ENSMUSG00000066568


For any suggestions or comments, please send an email to unitrap@crg.es