Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E119C03
Clone ID E119C03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE119C03
Sequence
GATGTCACAATAAGAGATGAAACAGCAGTGGAAGCTGGTAAGCCATTATAAGCCACCTTATGTCTTCCCTTGACTTTGGC
CCTGACAGCTGTACCTCTACATGGAAAGAGATTGAAGGGCAGCCAGGCTTCTAGTATGTACATGATAACCAATACTGGCC
TGGAGCCAGTATTCCTATTCCCATGGAGGAAGGTCCGAGGCCTCCCGG
Sequence Type genomic DNA
Unitrap ID UNI29681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96430432..96430639 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031748 (Gnao1) NM_010308 guanine nucleotide binding protein, alpha O Gene [Source:MGI Symbol;Acc:MGI:95775]

 
Come back to gene ENSMUSG00000031748


For any suggestions or comments, please send an email to unitrap@crg.es