Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E118E02
Clone ID E118E02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE118E02
Sequence
GATCTTGATATTCCATGTGATCTTTTATGGTATGATATTTCAGAGTACCATTTGTAGAATGAAAATGGAAGCTATAAGAC
CTCTTAGGACATTTTCAAATCGTACAGTATCATTCTTCCGAGAAGCATTCACCTGAGGGGGAGAAATGAAAAGGGAAAGT
CCGCTGCGTTCTATCTAGGCAGTCGTCGGGGCATTGCAGCAGGCACGTTCAGAATAACGTAAGGGCGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE118E02
Sequence
CTGGTTTGCCACAGATTTAGGTCATTTTAAGAATGTACATTCTTTAAAATGCCACCATTGCAGTTGCTTTAAAGTAATTA
ATACAGGAATTGGTAAGTAGATACATGTGGTTGAGTAATGATAATTTGTTTACATTGTTGATTGGTATGTGGAAGTTAAT
TTTTCTTTCTTTTTTGTATGTATAAGAATTTAATAGGAAATTTAAGTCACACAGCTCAGGTGATCTAAACTCTATTTTGT
GAATGTGACCTCATCTTAGTCTATAAGCACAGCATGTTTTGGTAGTTACTTTGTAGATGCCAAGGCTATCAACAGCTATT
TATGTTTGTGTCTGTGGG
Sequence Type genomic DNA
Unitrap ID UNI2331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60051576..60051913 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026977 (March7) NM_020575 membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI (curated);Acc:March7-003]

 
Come back to gene ENSMUSG00000026977


For any suggestions or comments, please send an email to unitrap@crg.es