Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST258
Clone ID KST258
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST258
Sequence
GANGGCCATCAATACCGTTCAGAAGTCTTGGACTGCAACTGCATATAAGGAATATGAGAAAATGAGCCTGCGAGATCTGA
TAAGGAGAAGTGGCCACAGCCAAAGGATCCCAAGGCCCAAACCTGCCCCGATGACTGATGAAATACAGCAACAAATTTTA
AATTTGCCAGAATCTTGGGACTGGAGAAACGTCCAAGGCGTCAATTATGTTAGCCCTGTTCGAAACCAAGAATCTTGTGG
AAGCTGCTACTCATTTGCCTCTATGGGTATGCTAGAAGCAAGAATTCGTATATTAACCAACAATTCTCAGACACCAATCC
TGAGTCCTCAGAGGTTGTATCTTCACCCCTATCCAA
Sequence Type mRNA
Unitrap ID UNI10268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 95447994..95456647 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030560 (Ctsc) NM_009982 cathepsin C Gene [Source:MGI (curated);Acc:Ctsc-001]

 
Come back to gene ENSMUSG00000030560


For any suggestions or comments, please send an email to unitrap@crg.es