Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E118D10
Clone ID E118D10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE118D10
Sequence
TTTTTGTCCTGTTTGTAGTTTCATCTGTTGGCTTTCTGAACTTTTCCTTGCAAAGCATGGAAAATGGAGCTCAAAAGGAA
CATATAATG
Sequence Type genomic DNA
Unitrap ID UNI5357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7961633..7961721 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]


SPLK-Sequence tag 3SE118D10
Sequence
AAAGCATTAGCAGTGAAGAGAATCTNNGCTGTGGACTTAGTTTTATCTGTTGATCATACCTACAGCTGGGTNNNTAAGGA
AAGAGTGGGTATTTTGGGGTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es