Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E118D04
Clone ID E118D04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE118D04
Sequence
ATCTTCATAAATGTCAAAACCTTGTATCTGGCCTGTGTTAAAAGGG
Sequence Type genomic DNA
Unitrap ID UNI29684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18022172..18022217 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


SPLK-Sequence tag 3SE118D04
Sequence
TTAATGTAAACTTTTTTTTTCTAACAGTTTTTAATGCATAAGTAAATTATTTAGTATTAAAAGAAAAATAAGATATTTTA
AACAA
Sequence Type genomic DNA
Unitrap ID UNI29684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18022567..18022651 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es