Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E118A10
Clone ID E118A10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE118A10
Sequence
ACAGGGGTGTGGAGAAATGGCCCAGCACTTGCTAC
Sequence Type genomic DNA
Unitrap ID UNI29686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23809154..23809188 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041319 (Thoc6) NM_001008425 THO complex 6 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Thoc6-001]


SPLK-Sequence tag 3SE118A10
Sequence
ACTCGTCCAAGAAACCAAGTACAGCACCTATTACCCATATAGGAGTGGGCTTACAGCTGCTTGTAATCCAGTTCCAGGAG
GTCCAACACTCGACACTGCACATACACGCGCACACACGCACGCATGTACATGCACACACACACACATGCATGTACACTCA
TGCACAAGACAGAAGCAAGAAG
Sequence Type genomic DNA
Unitrap ID UNI29686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23808973..23809155 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041319 (Thoc6) NM_001008425 THO complex 6 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Thoc6-001]

 
Come back to gene ENSMUSG00000041319


For any suggestions or comments, please send an email to unitrap@crg.es